 |
Enterococcus faecalis
Enterococci are involved in serious infections in humans,
although they were classically considered more as a commensal
of the gastrointestinal tract of humans and animals rather
than a specialized human pathogen. The enterococcal species
responsible for most infections both in community and hospital
settings is Enterococcus faecalis. The E. faecalis MLST scheme
was established to provide a reference scheme for typing
of E. faecalis and to allow unambiguous comparison of data
between different laboratories. Those carrying out MLST on
this species are encouraged to submit their data to the curator
so that the strain details can be added to the database.
In this way the MLST database becomes an increasingly useful
resource for the E. faecalis community.
The MLST scheme was developed by Patricia Ruiz Garbajosa
and Rob Willems in the laboratory of Marc Bonten at the University
Medical Center Utrecht, Utrecht, the Netherlands. Part of
the initial strains were kindly provided by Barbara Murray.
Obtaining an allelic profile and comparing your
strains with those in our database.
The allelic profile of an E. faecalis strain is obtained
by sequencing internal fragments of seven house-keeping
genes. The primers for the amplification and sequencing
of these
gene fragments can be obtained here The sequences must
be obtained on both strands, and they must be 100% accurate,
since even a single error may convert a known allele into
a novel allele.
The sequences have to be trimmed so that they correspond
exactly to the region that we use to define the alleles.
The sequences of the seven loci from a typical E. faecalis can be obtained here and can be used to ensure that your
sequences have been trimmed correctly.
You then need to access our databases, which involves a
simple registration process, that allows us to inform you
of new
developments by e-mail.
For a query isolate, the sequences at the seven loci have
to be compared with those in our database. Select the E.
faecalis database, and the locus
query drop-down
menu. Select single locus and paste the correctly trimmed
sequence
into
the box. Select the appropriate locus in the drop-down
menu, followed by submit query.
The software will check that the sequence is the correct
length and that it does not contain any unrecognised
characters. A check is also made to see if the submitted
sequence is
at least 70% similar to another allele at that locus
(in case you have cut and pasted a sequence into the
wrong
box). If the sequence corresponds to a known allele,
the allele
number will be returned. If the sequence appears to be
a new allele it should be compared with the most similar
locus
(or loci) to check that any sequence differences are
real. If you are convinced you have a new allele, the
forward
and reverse traces from the sequencer should be sent
to the curator
who will check their quality and if OK will assign a
new allele number.
After you have obtained the allele numbers at each locus
for your query strain, you select profile query and in
the drop-down menu select allelic and enter the seven
allele numbers in the appropriate boxes and submit. If
the allelic
profile is in the database, the sequence type assigned
to
this allelic profile will be returned. Otherwise the
most similar allelic profile will be returned. You can
then
search for isolates that have allelic profiles that are
similar
to yours. For example, isolates that have at least 4/7,
5/7 or 6/7 matches to the submitted allelic profile and
can show
the relationships between your query strain and these
strains by using the Tree button.
Further details about strains that are identical, or
similar, to the submitted strain can be obtained by clicking
on
the strain names.
Help boxes are available on some pages.
Primers and PCR conditions for MLST of E. faecalis
The primers that are used and the PCR conditions that we
use in our laboratory are shown below. PCR conditions may
need to be modified slightly in others laboratories. Since
the same primers are used for the initial amplification,
and for sequencing, it is important that PCR conditions
are used which result in the amplification of only the
desired fragment.
The following primer sequences were used:
| Genes and Function |
Sequences (5'-3') |
Size of amplicon used for assigning alleles |
| glucose-6-phosphate dehydrogenase |
|
|
| gdh-1 |
GGCGCACTAAAAGATATGGT |
530 |
| gdh-2 |
CCAAGATTGGGCAACTTCGTCCCA |
|
| |
|
|
| glyceraldehydes-3-phosphate dehydrogenase |
|
|
| gyd-1 |
CAAACTGCTTAGCTCCAATGGC |
395 |
| gyd-2 |
CATTTCGTTGTCATACCAAGC |
|
| |
|
|
| phosphate ATP binding cassette transporter |
|
|
| pstS-1 |
CGGAACAGGACTTTCGC |
583 |
| pstS-2 |
ATTTACATCACGTTCTACTTGC |
|
| |
|
|
| glucokinase |
|
|
| gki-1 |
GATTTTGTGGGAATTGGTATGG |
438 |
| gki-2 |
ACCATTAAAGCAAAATGATCGC |
|
| |
|
|
| shikimate-5-dehydrogenase |
|
|
| aroE-1 |
TGGAAAACTTTACGGAGACAGC |
459 |
| aroE-2 |
GTCCTGTCCATTGTTCAAAAGC |
|
| |
|
|
| xanthine phosphoribosyltransferase |
|
|
| xpt-1 |
AAAATGATGGCCGTGTATTAGG |
456 |
| xpt-2 |
AACGTCACCGTTCCTTCACTTA |
|
| |
|
|
| acetyl-CoA acetyltransferase |
|
|
| yiqL-1 |
CAGCTTAAGTCAAGTAAGTGCCG |
436 |
| yiqL-2 |
GAATATCCCTTCTGCTTGTGCT |
|
| |
|
|
PCR conditions
In our laboratory, PCR conditions for all amplification reactions
were as follows: initial denaturation at 94ºC for
5min; 30 cycles at 94ºC for 30s, 52ºC for 30s
and 72ºC for 1m; and extension at 72ºC for 7m.
Reactions were performed in 25?l volumes with buffer and
Taq polymerase SphaeroQ (Leiden, The Netherlands). PCR
products were purified with a PCR purification kit from
Qiagen Inc. (Hilden, Germany) and sequenced with PCR forward
or reverse primers, an ABI PRISM Big Dye Cycle Sequencing
Ready Reaction kit (Perkin-Elmer, Applied Biosystems, Foster
City, Calif.) and ABI 3700 DNA sequencer (Perkin-Elmer).
|
 |