mlst.net | efaecalis.mlst.net
 
DATA ANALYSIS
DATABASES
B.burgdorferi
B.cereus
B.henselae
B.pseudomallei
C.albicans
C.glabrata
C.krusei
C.tropicalis
C.jejuni
C.neoformans var grubii
E.coli
E.faecalis
E.faecium
H.influenzae
H.pylori
Leptospira spp.
M.catarrhalis
N.meningitidis
S.agalactiae
S.aureus
S.dysgalactiae
S.enterica
S.epidermidis
S.pneumoniae
S.pyogenes
S.suis
V.vulnificus
SUBMISSIONS
NEWS
LINKS
 

Enterococcus faecalis

Enterococci are involved in serious infections in humans, although they were classically considered more as a commensal of the gastrointestinal tract of humans and animals rather than a specialized human pathogen. The enterococcal species responsible for most infections both in community and hospital settings is Enterococcus faecalis. The E. faecalis MLST scheme was established to provide a reference scheme for typing of E. faecalis and to allow unambiguous comparison of data between different laboratories. Those carrying out MLST on this species are encouraged to submit their data to the curator so that the strain details can be added to the database. In this way the MLST database becomes an increasingly useful resource for the E. faecalis community.

The MLST scheme was developed by Patricia Ruiz Garbajosa and Rob Willems in the laboratory of Marc Bonten at the University Medical Center Utrecht, Utrecht, the Netherlands. Part of the initial strains were kindly provided by Barbara Murray.

Obtaining an allelic profile and comparing your strains with those in our database.

The allelic profile of an E. faecalis strain is obtained by sequencing internal fragments of seven house-keeping genes. The primers for the amplification and sequencing of these gene fragments can be obtained here The sequences must be obtained on both strands, and they must be 100% accurate, since even a single error may convert a known allele into a novel allele.
The sequences have to be trimmed so that they correspond exactly to the region that we use to define the alleles. The sequences of the seven loci from a typical E. faecalis can be obtained here and can be used to ensure that your sequences have been trimmed correctly.
You then need to access our databases, which involves a simple registration process, that allows us to inform you of new developments by e-mail.


For a query isolate, the sequences at the seven loci have to be compared with those in our database. Select the E. faecalis database, and the locus query drop-down menu. Select single locus and paste the correctly trimmed sequence into the box. Select the appropriate locus in the drop-down menu, followed by submit query.

The software will check that the sequence is the correct length and that it does not contain any unrecognised characters. A check is also made to see if the submitted sequence is at least 70% similar to another allele at that locus (in case you have cut and pasted a sequence into the wrong box). If the sequence corresponds to a known allele, the allele number will be returned. If the sequence appears to be a new allele it should be compared with the most similar locus (or loci) to check that any sequence differences are real. If you are convinced you have a new allele, the forward and reverse traces from the sequencer should be sent to the curator who will check their quality and if OK will assign a new allele number.

After you have obtained the allele numbers at each locus for your query strain, you select profile query and in the drop-down menu select allelic and enter the seven allele numbers in the appropriate boxes and submit. If the allelic profile is in the database, the sequence type assigned to this allelic profile will be returned. Otherwise the most similar allelic profile will be returned. You can then search for isolates that have allelic profiles that are similar to yours. For example, isolates that have at least 4/7, 5/7 or 6/7 matches to the submitted allelic profile and can show the relationships between your query strain and these strains by using the Tree button.

Further details about strains that are identical, or similar, to the submitted strain can be obtained by clicking on the strain names.

Help boxes are available on some pages.

 

Primers and PCR conditions for MLST of E. faecalis

The primers that are used and the PCR conditions that we use in our laboratory are shown below. PCR conditions may need to be modified slightly in others laboratories. Since the same primers are used for the initial amplification, and for sequencing, it is important that PCR conditions are used which result in the amplification of only the desired fragment.

The following primer sequences were used:

Genes and Function Sequences (5'-3') Size of amplicon used for assigning alleles
glucose-6-phosphate dehydrogenase  
gdh-1 GGCGCACTAAAAGATATGGT
530
gdh-2 CCAAGATTGGGCAACTTCGTCCCA
   
glyceraldehydes-3-phosphate dehydrogenase  
gyd-1 CAAACTGCTTAGCTCCAATGGC
395
gyd-2 CATTTCGTTGTCATACCAAGC
   
phosphate ATP binding cassette transporter  
pstS-1 CGGAACAGGACTTTCGC
583
pstS-2 ATTTACATCACGTTCTACTTGC
   
glucokinase  
gki-1 GATTTTGTGGGAATTGGTATGG
438
gki-2 ACCATTAAAGCAAAATGATCGC
   
shikimate-5-dehydrogenase  
aroE-1 TGGAAAACTTTACGGAGACAGC
459
aroE-2 GTCCTGTCCATTGTTCAAAAGC
   
xanthine phosphoribosyltransferase  
xpt-1 AAAATGATGGCCGTGTATTAGG
456
xpt-2 AACGTCACCGTTCCTTCACTTA
   
acetyl-CoA acetyltransferase  
yiqL-1 CAGCTTAAGTCAAGTAAGTGCCG
436
yiqL-2 GAATATCCCTTCTGCTTGTGCT
   

PCR conditions

In our laboratory, PCR conditions for all amplification reactions were as follows: initial denaturation at 94ºC for 5min; 30 cycles at 94ºC for 30s, 52ºC for 30s and 72ºC for 1m; and extension at 72ºC for 7m. Reactions were performed in 25?l volumes with buffer and Taq polymerase SphaeroQ (Leiden, The Netherlands). PCR products were purified with a PCR purification kit from Qiagen Inc. (Hilden, Germany) and sequenced with PCR forward or reverse primers, an ABI PRISM Big Dye Cycle Sequencing Ready Reaction kit (Perkin-Elmer, Applied Biosystems, Foster City, Calif.) and ABI 3700 DNA sequencer (Perkin-Elmer).


 
Profile Query

 
Locus Query

Batch Query